This page was produced as an assignment for Genetics 677, an undergraduate course at UW-Madison.

Mutant Phenotypes

Many of the orthologs of human GRM7, including the chimpanzee, chicken, dog, and zebrafish orthologs, are currently only predicted proteins, and therefore, have not yet been studied. However, in C. elegans, fruit fly, mouse, and rat, the proteins orthologous to human GRM7 have been knocked down, using either RNAi or targeted knock-out, and the resulting phenotype of the mutant organism studied. Below summarizes the findings of these studies on GRM7 mutants.

RNAi in C. elegans

The C. elegans ortholog of GRM7, mgl-1, was queried in WormBase to determine the phenotypes caused by RNAi knock-down of this gene. The only phenotype observed from RNAi knockdown of mgl-1, according to WormBase, was a slow post-embryonic growth rate (Kamath, et al., 2003). Based on the knowledge that the metabotropic glutamate receptor encoded by mgl-1 plays a role in receiving and transmitting glutamate signals, loss of mgl-1 expression probably causes slow growth rate because of a reduction in the ability of C. elegans to receive and/or transmit growth signals (Wormbase, 2009). RNAi knockdown of mgl-1 did not result in phenotypes for abnormal fat content, maternal sterility, defects in nonanone chemotaxis, lethality, embryonic lethality, abnormal isothermal tracking behavior, abnormal organism morphology, egg laying defects, or reduced pharyngeal pumping (Wormbase, 2009). These results indicate that mgl-1 is not absolutely necessary for survival, nor does it play a role in reproduction, external morphology, fat content, nonanone chemotaxis, isothermal tracking behavior, or pharyngeal pumping (Wormbase, 2009). Additional RNAi experiments that look more fully at the phenotypes caused by RNAi knock-down of mgl-1 are needed to better understand the role this gene plays in C. elegans, as well as to provide more insight into how its human homolog, GRM7, contributes to alcoholism.


RNAi in Fruit Flies

The D. melanogaster homolog of GRM7, mGluRA, was queried in FlyBase to determine the phenotypes caused by RNAi knock-down of this gene (Tweedie, et al., 2009). Only one experiment in which RNAi was used was found (FlyBase, 2009). In this particular experiment, knock-down of mGluRA by RNAi caused neurophysiological defects in pre-synaptic excitability and synaptic morphology (Bogdanik, 2004). Based on the known role of metabotropic glutamate receptors in glutamate transmission, it would be expected that knock-down of mGluRA would cause defects in neurotransmission; it is interesting, however, that this protein also plays a role in synaptic morphology (Bogdanik, 2004). Perhaps in humans, variations in the mGluRA homolog GRM7 also cause alterations in the morphology of neural synapses or in the level pre-synaptic excitability that occurs during glutamate transmission that lead to increased susceptibility to alcoholism (Bogdanik, 2004). Further experimentation on mGluRA is needed, however, to gain better insight into how its human homolog GRM7 contributes to alcoholism.


Targeted Knock-Out in Mice

The mouse homolog of human GRM7, Grm7, was queried in the Mouse Genome Informatics website, using the Mouse Genome Database, to determine the phenotypes caused by knock-down of the gene (Bult, et al., 2008). The database revealed that mice homozygous for a deletion in Grm7 showed defects in their behavior and in their nervous systems (Bult, et al., 2008). Specifically, the mice "displayed defects in scheduled appetitive conditioning, acquisition and extinction of appetitive odor conditioning, extinction of response suppression-based conditioned emotional responding (CER), acquisition of discriminative CER, and contextual fear conditioning" (Goddyn, et al., 2008). Additionally, the knock-out mice had slower rates of associative learning as compared to wildtype litter mates (Goddyn, et al., 2008). This study suggests that human GRM7, like mouse Grm7, plays an important role in a wide variety of neurocognitive functions (Goddyn, et al., 2008).


RNAi in Rats

To determine mutant phenotypes observed in the rat (Rattus norvegicus) when GRM7 function was knocked down, Pubmed and Google were searched with the query "Grm7 rat." Pubmed did not return any results. There were also no studies found on Google in which Grm7 (the rat ortholog of human GRM7) function had been knocked-down in the rat, either with a gene knock-out or by RNAi. However, Google did return one interesting study in which an endogenous microRNA (miRNA), miR-34a, was found to regulate levels of Grm7 (Zhou, et al., 2009). In this study, downregulation of miR-34a resulted in upregulation of Grm7, and conversely that downregulation of miR-34a resulted in upregulation of Grm7 (Zhou, et al., 2009). The results of this study indicate that miR-34a may be useful for perturbing the levels of Grm7 in future studies of its function in rats, both in vivo and in vitro (Zhou, et al., 2009). One potentially interesting study that could be conducted in vivo, would be to asses levels of alcohol preference is rats in which miR-34a was upregulated, at normal levels, or downregulated.


RNAi in Humans

To find RNAi molecules with the potential to knock-down the function of GRM7 in humans, the human GRM7 isoform a mRNA sequence was queried on Ambion's siRNA Target Finder website. Ambion's siRNA Target Finder designs small interferring RNA (siRNA) sequences 21 nucleotides in length that have the potential to intefere with expression of the mRNA input into their website. For human GRM7 isoform a mRNA, the siRNA Target Finder identified 222 potential siRNAs, the first three of which are shown in Table 1. Ambion claims that approximately 50% of the siRNAs identified by their tool will knockdown expression levels of that particular mRNA by greater than 50% (Applied Biosystems, 2009).  Therefore, while human GRM7 could not be knocked down in vivo for other reasons, these siRNA molecules could potentially be useful in performing experiments in vitro on human cell cultures.

Position in GRM7 mRNA

 

Position in GRM7 mRNA

siRNA molecule

76

5'-   GGGCCCGGACCUCGGCGAGUU -3'

 

3'- UUCCCGGGCCUGGAGCCGCUC   -5'

165

5'-   GCUGCUCCGCGUCCUGACUUU -3'

 

3'- UUCGACGAGGCGCAGGACUGA   -5'

192

5'-   GUUCCCCUGCUGCGUGCUGUU -3'

 

3'- UUCAAGGGGACGACGCACGAC   -5'

 

Figure 1. siRNA targets for human GRM7 isoform a mRNA. The human GRM7 isoform a mRNA sequence was queried on Ambion’s siRNA Target Finder using only the constraint that siRNA molecules with more than four repeats of any one particular base in a row should be avoided. 222 siRNA molecules were returned by the siRNA Target Finder; the table above shows the first three returned (the sequences are listed on by positional order, so the three siRNAs shown have the three farthest upstream targets on the human GRM7 isoform a mRNA of all the siRNA molecules returned) (Applied Biosystems, 2009). The first column of the table above gives the starting position of the segment on the human GRM7 isoform a mRNA sequence to which the siRNA molecule is targeted (Applied Biosystems, 2009). The second column gives the sense (on top, running 5’ to 3’) and antisense (on the bottom, running 3’ to 5’) strands of the siRNA molecules designed to target the human GRM7 isoform a mRNA (Applied Biosystems, 2009).

References

 

References

 

Applied Biosystems. (2009). siRNA Target Finder. Retrieved March 28, 2009, from http://www.ambion.com/techlib/misc/siRNA_finder.html.

Bogdanik, L., Mohrmann, R., Ramaekers, A., Bockaert, J., Grau, Y., Broadie, K., Parmentier, M.L. (2004). The Drosophila metabotropic glutamate receptor DmGluRA regulates activity-dependent synaptic facilitation and fine synaptic morphology.  J. Neurosci. 24(41): 9105--9116.

Bult, C.J., Eppig, J.T., Kadin, J.A., Richardson, J.E., Blake, J.A.; and the members of the Mouse Genome Database Group. (2008). The Mouse Genome Database (MGD): mouse biology and model systems. Nucleic Acids Res 36(Database issue):D724. doi:10.1093/nar/gkm961

FlyBase. (2009). Gene Dmel\mGluRA. Retrieved March 28, 2009, from http://flybase.org/reports/FBgn0019985.html.

Goddyn, H., Callaerts-Vegh, Z., Stroobants, S., Dirikx, T., Vansteenwegen, D., Hermans, D., van der Putten, H., D’Hooge, R. (2008). Deficits in acquisition and extinction of conditioned responses in mGluR7 knockout mice. Neurobiology of Learning and Memory, 90(1):103. doi:10.1016/j.nlm.2008.01.001.

Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D.P., Zipperlen, P., Ahringer, J. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature, 421(6920):231-7. doi:10.1038/nature01278

Tweedie, S., Ashburner, M., Falls, K., Leyland, P., McQuilton, P., Marygold, S., Millburn, G., Osumi-Sutherland, D., Schroeder, A., Seal,  R.,  Zhang, H., and The FlyBase Consortium. (2009). FlyBase: enhancing Drosophila Gene Ontology annotations. Nucleic Acids Research 37: D555-D559. doi:10.1093/nar/gkn788.

Wormbase. (2009). Gene Summary for mgl-1. Retrieved March 28, 2009, from http://www.wormbase.org/db/gene/gene?name=WBGene00003232;class=Gene.

Zhou, R., Yuan, P., Wang, Y., Hunsberger, J.G., Elkahloun, A., Wei, Y., Damschroder-Williams, P., Du, J., Chen, G., and Manji, H.K. (2009). Evidence for Selective microRNAs and Their Effectors as Common Long-Term Targets for the Actions of Mood Stabilizers. Neuropsychopharmacology, 34(6):1395. doi:10.1038/npp.2008.131.


Jennifer Wagner
wagner4@wisc.edu
Updated May 11, 2009
http://www.gen677.weebly.com